Respuestas

2013-08-22T03:50:19+02:00
A través de un examen de adn, necesitas que sea más específico en cuanto a reacciones químicas por las cuales se hayan estos?
mediante el cuadro de punnett se me dificulta hacerlo... podrias ayudarme?
2013-08-22T03:52:46+02:00
Llamamos fenotipo al conjunto de caracteres morfológicos, funcionales, bioquímicos, conductuales, etc., que presenta un ser vivo. Gran parte del fenotipo es hereditario, esto es, corresponde a las características que un ser vivo recibe de sus progenitores; pero no todo el fenotipo lo es. Por ejemplo, una persona que ha aprendido a tocar el piano puede llegar a hacerlo muy bien a través del ejercicio y del aprendizaje. Saber tocar el piano es sin duda una característica fenotípica; sin embargo, ésta característica fenotípica no se hereda. Por, el contrario, el grupo sanguíneo, que también es una característica fenotípica, está determinado por los grupos sanguíneos de los progenitores.El genotipo es el conjunto de genes que presenta un individuo. Muy frecuentemente estos genes determinan características que aparecen en el fenotipo; otras veces los genes no llegan a manifestarse. Así, una persona que tenga el grupo sanguíneo A puede tener un genotipo A0, es decir, un gen parental determina la presencia del carácter A y el otro gen parental 0; pero en este caso la presencia de A (carácter dominante) se impone a la característica 0 (carácter recesivo); el individuo es fenotípicamente A aunque también tenga el gen correspondiente al grupo 0.El genotipo es un conjunto de información, es decir, una serie de instrucciones concretas mediante las cuales el ser vivo construye su fenotipo. Hoy sabemos que esta información tiene una estructura análoga al lenguaje (hablado o escrito) pero con cuatro letras (A,T,G y C) en lugar de las 26 del alfabeto latino. Esta información está constituída por una macromolécula lineal, el ácido desoxirribonucleico (ADN, DNA), que es un polímero constituído por la unión de monómeros de cuatro tipos distintos (los mencionados como A,T, G y C), de manera que una "frase" escrita en "lenguaje DNA" sería algo como esto:ATTCGGCTTACGTTGAACTGTCCATCGAGGTAACTTCCTTTTACCG
y como lo haria mediante el cuadro de punnett?